Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5439992
End position: 5440015
Length: 24

DNA sequence
>NC_021658, from 5439992 to 5440015 (24 bp); Sorangium cellulosum So0157-2 AGCTCGAGCGCGAGCTCGAGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5438504-5440075	Sequence	SCE1572_19220 - hypothetical protein (Protein is coded in complementary strand; from 5440075 to 5438504)