Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5409869
End position: 5409922
Length: 54

DNA sequence
>NC_021658, from 5409869 to 5409922 (54 bp); Sorangium cellulosum So0157-2 CTCGCCGCCGCCGCTGGTCACGCCGCCGCTGGTGGTCGCGCCGCCGCCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5408871-5410067	Sequence	SCE1572_19105 - hypothetical protein (Protein is coded in complementary strand; from 5410067 to 5408871)