Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5385358
End position: 5385402
Length: 45

DNA sequence
>NC_021658, from 5385358 to 5385402 (45 bp); Sorangium cellulosum So0157-2 GAGCCGGCGTCGCCCGTGCCGGCGTCGCCCGCGCCGGCGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5384905-5385360	Sequence	SCE1572_19020 - hypothetical protein
ORF... 5385374-5386420	Sequence	SCE1572_19025 - chromosome partitioning protein ParA