Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5364449
End position: 5364484
Length: 36

DNA sequence
>NC_021658, from 5364449 to 5364484 (36 bp); Sorangium cellulosum So0157-2 CCCTCGTCGCGACCCTCGTCGCGACCCTCGTCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5364260-5365168	Sequence	SCE1572_18935 - hypothetical protein (Protein is coded in complementary strand; from 5365168 to 5364260)