Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5355548
End position: 5355571
Length: 24

DNA sequence
>NC_021658, from 5355548 to 5355571 (24 bp); Sorangium cellulosum So0157-2 CCGCCGCCGCCCCCGTCGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5353574-5355685	Sequence	SCE1572_18895 - hypothetical protein (Protein is coded in complementary strand; from 5355685 to 5353574)