Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5276391
End position: 5276414
Length: 24

DNA sequence
>NC_021658, from 5276391 to 5276414 (24 bp); Sorangium cellulosum So0157-2 CTCGAGCTCGTGCCCGAGCTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5275414-5276490	Sequence	SCE1572_18625 - teichoic acid biosynthesis protein (Protein is coded in complementary strand; from 5276490 to 5275414)