Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5232603
End position: 5232626
Length: 24

DNA sequence
>NC_021658, from 5232603 to 5232626 (24 bp); Sorangium cellulosum So0157-2 GCGGCGACGGCGGCCGCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5232416-5233726	Sequence	SCE1572_18450 - hypothetical protein (Protein is coded in complementary strand; from 5233726 to 5232416)