Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5163433
End position: 5163456
Length: 24

DNA sequence
>NC_021658, from 5163433 to 5163456 (24 bp); Sorangium cellulosum So0157-2 GCGAGCGCGCGCGCGAGCGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5163091-5164371	Sequence	SCE1572_18220 - hypothetical protein (Protein is coded in complementary strand; from 5164371 to 5163091)