Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5146285
End position: 5146329
Length: 45

DNA sequence
>NC_021658, from 5146285 to 5146329 (45 bp); Sorangium cellulosum So0157-2 CGCCGGCGTCGCGGCCGCGGGCGTGGTGGCCGCCGGCTTGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5144585-5146378	Sequence	SCE1572_18145 - hypothetical protein (Protein is coded in complementary strand; from 5146378 to 5144585)
ORF... 5146308-5146835	Sequence	SCE1572_18150 - hypothetical protein