Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5144982
End position: 5145035
Length: 54

DNA sequence
>NC_021658, from 5144982 to 5145035 (54 bp); Sorangium cellulosum So0157-2 TCGCGGCCGGCGCCGCGGTCTCGGTGGGCGCCGCGGTCTCGGCGGGCGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5144585-5146378	Sequence	SCE1572_18145 - hypothetical protein (Protein is coded in complementary strand; from 5146378 to 5144585)