Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5109354
End position: 5109416
Length: 63

DNA sequence
>NC_021658, from 5109354 to 5109416 (63 bp); Sorangium cellulosum So0157-2 TCCGGGGCCGCGGAGGCGCCGTCCGGGGCCGCGGAGGCGCCTTCCACGGGCGCGGCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5109300-5109518	Sequence	SCE1572_18025 - hypothetical protein (Protein is coded in complementary strand; from 5109518 to 5109300)