Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5069567
End position: 5069590
Length: 24

DNA sequence
>NC_021658, from 5069567 to 5069590 (24 bp); Sorangium cellulosum So0157-2 GAGGCGGGGCGGCGGGGCGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5069001-5069723	Sequence	SCE1572_17860 - hypothetical protein (Protein is coded in complementary strand; from 5069723 to 5069001)