Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 5005355
End position: 5005378
Length: 24

DNA sequence
>NC_021658, from 5005355 to 5005378 (24 bp); Sorangium cellulosum So0157-2 TCCGCCTCCTCCTCCGCGTCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5004086-5005543	Sequence	SCE1572_17710 - hypothetical protein (Protein is coded in complementary strand; from 5005543 to 5004086)