Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4949243
End position: 4949278
Length: 36

DNA sequence
>NC_021658, from 4949243 to 4949278 (36 bp); Sorangium cellulosum So0157-2 GCGGCCGCCGGCGCTGCTGCCGGCGCTGCCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4949177-4949878	Sequence	SCE1572_17490 - hypothetical protein (Protein is coded in complementary strand; from 4949878 to 4949177)