Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4915632
End position: 4915655
Length: 24

DNA sequence
>NC_021658, from 4915632 to 4915655 (24 bp); Sorangium cellulosum So0157-2 GTACGCGTACGGGCACGCGTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4914898-4916640	Sequence	SCE1572_17385 - hypothetical protein (Protein is coded in complementary strand; from 4916640 to 4914898)