Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4913886
End position: 4913909
Length: 24

DNA sequence
>NC_021658, from 4913886 to 4913909 (24 bp); Sorangium cellulosum So0157-2 CGTCGTTGTCGTCGTCGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4912589-4914796	Sequence	SCE1572_17380 - hypothetical protein (Protein is coded in complementary strand; from 4914796 to 4912589)