Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4889813
End position: 4889839
Length: 27

DNA sequence
>NC_021658, from 4889813 to 4889839 (27 bp); Sorangium cellulosum So0157-2 CACCGCCGCCACCGCCGCCACCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4888831-4889967	Sequence	SCE1572_17290 - hypothetical protein (Protein is coded in complementary strand; from 4889967 to 4888831)