Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4887605
End position: 4887649
Length: 45

DNA sequence
>NC_021658, from 4887605 to 4887649 (45 bp); Sorangium cellulosum So0157-2 GTCATCCCGGGCGCCGGCATCCCGGGCGCCGGCATCCCGGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4887020-4887640	Sequence	SCE1572_17285 - hypothetical protein (Protein is coded in complementary strand; from 4887640 to 4887020)