Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 485494
End position: 485520
Length: 27

DNA sequence
>NC_021658, from 485494 to 485520 (27 bp); Sorangium cellulosum So0157-2 CGTCGTCCGCGTCGTGCGCGTCGTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 482745-486317	Sequence	SCE1572_01825 - hypothetical protein (Protein is coded in complementary strand; from 486317 to 482745)