Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4813520
End position: 4813543
Length: 24

DNA sequence
>NC_021658, from 4813520 to 4813543 (24 bp); Sorangium cellulosum So0157-2 CGCGCCCCCGCCCCCGCCCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4812408-4813658	Sequence	SCE1572_17055 - hypothetical protein (Protein is coded in complementary strand; from 4813658 to 4812408)