Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4728565
End position: 4728588
Length: 24

DNA sequence
>NC_021658, from 4728565 to 4728588 (24 bp); Sorangium cellulosum So0157-2 CGCCTCCTCCTCCGCCTGCGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4728560-4730071	Sequence	SCE1572_16875 - type 12 methyltransferase (Protein is coded in complementary strand; from 4730071 to 4728560)