Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4678697
End position: 4678721
Length: 25

DNA sequence
>NC_021658, from 4678697 to 4678721 (25 bp); Sorangium cellulosum So0157-2 CCGCGACGCGCCGCCCGGCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4677705-4678952	Sequence	SCE1572_16710 - hypothetical protein (Protein is coded in complementary strand; from 4678952 to 4677705)