Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4670214
End position: 4670240
Length: 27

DNA sequence
>NC_021658, from 4670214 to 4670240 (27 bp); Sorangium cellulosum So0157-2 GGCTCCTCCGGCTCCTCGGGTTCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4669695-4670786	Sequence	SCE1572_16685 - hypothetical protein (Protein is coded in complementary strand; from 4670786 to 4669695)