Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4473086
End position: 4473109
Length: 24

DNA sequence
>NC_021658, from 4473086 to 4473109 (24 bp); Sorangium cellulosum So0157-2 GCGGCGACGGCGGCGGCCGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4472201-4473154	Sequence	SCE1572_15960 - hypothetical protein (Protein is coded in complementary strand; from 4473154 to 4472201)