Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4425658
End position: 4425687
Length: 30

DNA sequence
>NC_021658, from 4425658 to 4425687 (30 bp); Sorangium cellulosum So0157-2 ACCGCGCGACACCGCACGATACCGCGATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4425630-4425914	Sequence	SCE1572_15810 - hypothetical protein (Protein is coded in complementary strand; from 4425914 to 4425630)