Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4415426
End position: 4415449
Length: 24

DNA sequence
>NC_021658, from 4415426 to 4415449 (24 bp); Sorangium cellulosum So0157-2 CGCCGTCGCCGTCGTCGTCCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4415035-4416627	Sequence	SCE1572_15775 - hypothetical protein (Protein is coded in complementary strand; from 4416627 to 4415035)