Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4343374
End position: 4343409
Length: 36

DNA sequence
>NC_021658, from 4343374 to 4343409 (36 bp); Sorangium cellulosum So0157-2 TCGCCGCGCTCGCCGCGCTCGCCGCGCTCGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4341987-4343648	Sequence	SCE1572_15550 - hypothetical protein (Protein is coded in complementary strand; from 4343648 to 4341987)