Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4239251
End position: 4239274
Length: 24

DNA sequence
>NC_021658, from 4239251 to 4239274 (24 bp); Sorangium cellulosum So0157-2 GTCCTCGTCTTCGTCCTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4239171-4240340	Sequence	SCE1572_15155 - hypothetical protein (Protein is coded in complementary strand; from 4240340 to 4239171)