Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4220483
End position: 4220506
Length: 24

DNA sequence
>NC_021658, from 4220483 to 4220506 (24 bp); Sorangium cellulosum So0157-2 GGCGGAGGAGGAGGCGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4219466-4220563	Sequence	SCE1572_15070 - hypothetical protein (Protein is coded in complementary strand; from 4220563 to 4219466)