Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 4106254
End position: 4106277
Length: 24

DNA sequence
>NC_021658, from 4106254 to 4106277 (24 bp); Sorangium cellulosum So0157-2 GCGCGAGCTCGAGCGCGCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4104645-4108298	Sequence	SCE1572_14715 - hypothetical protein (Protein is coded in complementary strand; from 4108298 to 4104645)