Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3982080
End position: 3982109
Length: 30

DNA sequence
>NC_021658, from 3982080 to 3982109 (30 bp); Sorangium cellulosum So0157-2 CGCGGGCGCGGGCGCCGGCTCGGGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3981715-3982455	Sequence	SCE1572_14330 - hypothetical protein (Protein is coded in complementary strand; from 3982455 to 3981715)