Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3917377
End position: 3917424
Length: 48

DNA sequence
>NC_021658, from 3917377 to 3917424 (48 bp); Sorangium cellulosum So0157-2 CGCGCCGCGCGCCTCTCCGCGCGCCTCGCCGAGCGCCACGCCGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3917183-3917440	Sequence	SCE1572_14065 - hypothetical protein (Protein is coded in complementary strand; from 3917440 to 3917183)