Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3893016
End position: 3893078
Length: 63

DNA sequence
>NC_021658, from 3893016 to 3893078 (63 bp); Sorangium cellulosum So0157-2 GCGCGGGCGCGCAGAGGCCGAGCGCGGGCGCGCAGAGGCCGAGCGCCGGCGCGCGGAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3892493-3893152	Sequence	SCE1572_13970 - hypothetical protein
ORF. 3892998-3894971	Sequence	SCE1572_13975 - hypothetical protein (Protein is coded in complementary strand; from 3894971 to 3892998)