Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3867792
End position: 3867827
Length: 36

DNA sequence
>NC_021658, from 3867792 to 3867827 (36 bp); Sorangium cellulosum So0157-2 GCGAGCGCCCGCGCGAGCGCCGGCGCGACCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3866466-3868565	Sequence	SCE1572_13845 - hypothetical protein (Protein is coded in complementary strand; from 3868565 to 3866466)