Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3863372
End position: 3863407
Length: 36

DNA sequence
>NC_021658, from 3863372 to 3863407 (36 bp); Sorangium cellulosum So0157-2 GAGCTGATTCAAGAGCTGCGTCAAGAGCCGATTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3863250-3863924	Sequence	SCE1572_13820 - hypothetical protein (Protein is coded in complementary strand; from 3863924 to 3863250)