Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3797177
End position: 3797200
Length: 24

DNA sequence
>NC_021658, from 3797177 to 3797200 (24 bp); Sorangium cellulosum So0157-2 CGCCCTCGCCCTCGCCCTCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3795604-3799674	Sequence	SCE1572_13590 - hypothetical protein (Protein is coded in complementary strand; from 3799674 to 3795604)