Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3748924
End position: 3748947
Length: 24

DNA sequence
>NC_021658, from 3748924 to 3748947 (24 bp); Sorangium cellulosum So0157-2 GTTCTCGTTCTCGTTCTCGTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3748640-3751933	Sequence	SCE1572_13430 - hypothetical protein (Protein is coded in complementary strand; from 3751933 to 3748640)