Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3572309
End position: 3572332
Length: 24

DNA sequence
>NC_021658, from 3572309 to 3572332 (24 bp); Sorangium cellulosum So0157-2 CGTCGCCGTGGCGGTCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3572251-3574098	Sequence	SCE1572_12940 - hypothetical protein (Protein is coded in complementary strand; from 3574098 to 3572251)