Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3557818
End position: 3557841
Length: 24

DNA sequence
>NC_021658, from 3557818 to 3557841 (24 bp); Sorangium cellulosum So0157-2 ACGGCGACGGTGAAGGCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3557311-3558144	Sequence	SCE1572_12865 - formate transporter (Protein is coded in complementary strand; from 3558144 to 3557311)