Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3493312
End position: 3493356
Length: 45

DNA sequence
>NC_021658, from 3493312 to 3493356 (45 bp); Sorangium cellulosum So0157-2 CCCGGCCGGCGGCGCCTGGGCGGGCGGCGCCTCGGCGGACGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3491006-3493558	Sequence	SCE1572_12615 - hypothetical protein (Protein is coded in complementary strand; from 3493558 to 3491006)