Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3464118
End position: 3464165
Length: 48

DNA sequence
>NC_021658, from 3464118 to 3464165 (48 bp); Sorangium cellulosum So0157-2 GCCCTTCTCGATACCCTTCTCGACGCCCTGCTCCATGCCCTTCTCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3463927-3464889	Sequence	SCE1572_12525 - hypothetical protein (Protein is coded in complementary strand; from 3464889 to 3463927)