Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3444584
End position: 3444643
Length: 60

DNA sequence
>NC_021658, from 3444584 to 3444643 (60 bp); Sorangium cellulosum So0157-2 CGCGGCGGGAGCGCCCGCGGCCGGAGCGCCCGCGGCGGGAGCGCCCGCGGCCGGAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3444525-3445157	Sequence	SCE1572_12460 - hypothetical protein (Protein is coded in complementary strand; from 3445157 to 3444525)