Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3403225
End position: 3403251
Length: 27

DNA sequence
>NC_021658, from 3403225 to 3403251 (27 bp); Sorangium cellulosum So0157-2 CGCGGCGGACGCGGCGGACGCGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3402755-3403300	Sequence	SCE1572_12325 - hypothetical protein (Protein is coded in complementary strand; from 3403300 to 3402755)