Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3368484
End position: 3368510
Length: 27

DNA sequence
>NC_021658, from 3368484 to 3368510 (27 bp); Sorangium cellulosum So0157-2 CGAGCGCGGCGAGCGCGGCGAGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3367937-3368698	Sequence	SCE1572_12200 - short-chain dehydrogenase (Protein is coded in complementary strand; from 3368698 to 3367937)