Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3280484
End position: 3280507
Length: 24

DNA sequence
>NC_021658, from 3280484 to 3280507 (24 bp); Sorangium cellulosum So0157-2 GAGCACGAGCCCGAGCGCGACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3280356-3281249	Sequence	SCE1572_11895 - hypothetical protein (Protein is coded in complementary strand; from 3281249 to 3280356)