Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3211659
End position: 3211703
Length: 45

DNA sequence
>NC_021658, from 3211659 to 3211703 (45 bp); Sorangium cellulosum So0157-2 GGCGCGGCCGGCGCGGCGGGCTCGGCCGGCGCGGCGGGCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3209652-3212201	Sequence	SCE1572_11645 - hypothetical protein (Protein is coded in complementary strand; from 3212201 to 3209652)