Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3161770
End position: 3161814
Length: 45

DNA sequence
>NC_021658, from 3161770 to 3161814 (45 bp); Sorangium cellulosum So0157-2 GTGCCGCCAGGGCCCATGCCGCCGGTGCCCGTGCCGCCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3161065-3161787	Sequence	SCE1572_11515 - hypothetical protein (Protein is coded in complementary strand; from 3161787 to 3161065)