Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3155255
End position: 3155278
Length: 24

DNA sequence
>NC_021658, from 3155255 to 3155278 (24 bp); Sorangium cellulosum So0157-2 GCGGCGGCGTCGGCGGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3154332-3155255	Sequence	SCE1572_11480 - hypothetical protein
ORF. 3155234-3156622	Sequence	SCE1572_11485 - hypothetical protein