Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3136248
End position: 3136310
Length: 63

DNA sequence
>NC_021658, from 3136248 to 3136310 (63 bp); Sorangium cellulosum So0157-2 GAACGCCGGCGGTCCGGCTGAGTACGCTGGCGGTCCGGCTGAGGACGCCGGCGCTCCGGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3136235-3136435	Sequence	SCE1572_11395 - hypothetical protein (Protein is coded in complementary strand; from 3136435 to 3136235)