Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 3122868
End position: 3122892
Length: 25

DNA sequence
>NC_021658, from 3122868 to 3122892 (25 bp); Sorangium cellulosum So0157-2 CCGCGCGGCGCGGCGCAGCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3122653-3123177	Sequence	SCE1572_11340 - hypothetical protein (Protein is coded in complementary strand; from 3123177 to 3122653)